LC-MS/MS | Visikol

LC-MS/MS Quantification of the Methylation Status of Clinical Samples of NASH Liver Tissues

Carol Tomaszewski — Thu, 08 Sep 2022 13:37:12 +0000

Nonalcoholic fatty liver disease (NAFLD) is a common hepatic disorder in individuals who drink little or no alcohol. A key marker associated with NAFLD is the accumulation of fats in the liver (> 5% of liver weight). NAFLD is becoming a global health problem, and currently, almost one in four adults in the United States has NAFLD. NAFLD can progress to a more severe stage called nonalcoholic steatohepatitis (NASH), characterized by inflammation, cell injury, and fibrosis. Progression of NASH can lead to end-stage liver diseases such as liver cancer. It has been reported that aberrant epigenetic modification patterns are associated with inappropriate gene expression and the pathogenesis of NAFLD and NASH. It has been reported that histone modifications initiated the development of insulin resistance, a NAFLD-associated clinical trigger.[i] Another key epigenetic modification that controls the NAFLD and NASH progression is DNA methylation. DNA methyltransferases (DNMT) catalyze the transfer of the methyl group from S-adenosylmethionine (SAM) into DNA. Interestingly, hepatic DNMT expression levels in patients with steatohepatitis were increased relative to normal individuals.[ii] Moreover, relevant differences in the methylation patterns can distinguish patients with advanced versus mild NAFLD stages. Genes that regulate steatohepatitis, fibrosis, and carcinogenesis have the most dysregulation in their methylation status.[iii]

Recently, Visikol studied the epigenetics of four liver biopsies, two NASH patients, and two normal individuals, to establish the baseline levels of global DNA methylation and N⁶Me RNA methylation. DNA and RNA were extracted from the tissues using kits (Qiagen, Cat. Nos. 69504 and 74104), enzymatically hydrolyzed utilizing our optimized protocol, and finally, the targeted nucleosides were separated and quantified by our LC-MS/MS instrument. Figure 1 summarizes our findings on the baseline of the global DNA and RNA methylation from the clinical samples. Interestingly, one of the NASH livers showed a significant global DNA methylation percentage increase relative to the healthy baseline (Figure 1A). However, the global N⁶Me RAN methylation percentage was maintained among all the clinal samples (Figure 1B). These results suggest that in NASH liver2, post-translational mechanisms might be operating.

Figure 1. The top panel shows normal liver and NASH liver. The bottom panel shows Baseline global DNA methylation percentage (A), and global N⁶Me global RNA methylation (B) of liver tissues from healthy individuals and NASH patients quantified by LC-MS/MS.

If you are interested in working with Visikol on your next project, please reach out to our team today

[i] Ling C., Groop L. Epigenetics: A molecular link between environmental factors and type 2 diabetes. Diabetes. 2009, 58, 2718–2725.

[ii] Pirola CJ, Gianotti TF, Burgueño AL, Rey-Funes M, Loidl CF, Mallardi P, Martino JS, Castaño GO, Sookoian S. Epigenetic modification of liver mitochondrial DNA is associated with histological severity of nonalcoholic fatty liver disease. Gut., 2013, 62, 1356-1363.

[iii] Murphy SK, Yang H, Moylan CA, Pang H, Dellinger A, Abdelmalek MF, Garrett ME, Ashley-Koch A, Suzuki A, Tillmann HL, Hauser MA, Diehl AM. Relationship between methylome and transcriptome in patients with nonalcoholic fatty liver disease. Gastroenterology. 2013, 145, 1076-1087.

The post LC-MS/MS Quantification of the Methylation Status of Clinical Samples of NASH Liver Tissues first appeared on Visikol.

Gene-specific methylation analysis by LC-MS/MS

Carol Tomaszewski — Wed, 03 Aug 2022 13:01:51 +0000

DNA methylation is a critical epigenetic modification that controls gene expression and genome stability, which has oncogenic implications during cancer initiation. DNA methylation occurs mainly on the CpG islands, which are mainly enriched at gene promoters. Hypermethylated promoters have been shown to silence the corresponding gene expression, while hypomethylation has the opposite effect. Interestingly, cancer is associated with mixed DNA methylation dysregulation, which includes a genome-wide hypomethylation and hypermethylation associated with the silencing of vital tumor-suppressor genes.[i] Retrieving gene-methylation patterns is an important biomarker for early cancer prediction and other diseases.

Whole-genome bisulfite sequencing is a well-established protocol for detecting methylated cytosines in genomic DNA. This protocol uses bisulfite-based deamination of unmethylated cytosine into uracil bases, while the methylated cytosine bases are unaffected. During sequencing, uracil bases are deaminated into thymidine, while methylated cytosines, which resisted the deamination step, are sequenced into cytosines (Figure 1A). Site-specific quantification of the generated cytosines provides information on the methylation status of the selected DNA region. One of the tools that can be used to retrieve such information is the LC-MS/MS.

Figure 1. A) Overview of the bisulfite conversion-PCR sequence. B) LC-MS/MS selected base peak chromatogram of dC (top) at m/z 228.1/112.1 and 5mdC at m/z 242.1/126.1 (bottom) obtained from the enzymatic hydrolysis of 150 ng of the P53-amplified amplicon via DNA Degradase Plus (Zymo Research, E2021). As expected, 5mdC is not detected, which was lost during the bisulfite conversion step. Instead, a strong peak of dC was present in the P53 amplicon which is equivalent to the original methylation status of that gene.

Visikol has recently developed a sensitive bioanalytical method for the quantification of global DNA methylation by LC-MS/MS, which is based on the enzymatic hydrolysis of the genomic DNA and the simultaneous quantification of the corresponding nucleotides, 5-methyl-2’-deoxycytidine (5mdC), and 2’-deoxycytidine (dC), using the QTRAP 4000 mass spectrometer. This method was used to measure the changes in the global DNA methylation status of two cancer cell lines, A549 (human lung carcinoma) and HCT116 (human colorectal carcinoma), following the treatment with 5 µM of the DNA methyltransferase inhibitor 5-azacytidine (5-AZA). Using the DNA samples extracted from the 5-AZA-treated HCT116 cancer cell line, we extended the applicability of our method to quantify DNA methylation of the promoter region of the tumor suppressor gene, the p53 gene. Briefly, DNA samples were bisulfite converted, which then underwent a PCR amplification based on the following primers: ATTGTTTAGTTTTGTGTTAGGAGTTT, forward strand, and TCAATCAAAAACTTACCCAATCC for the reverse strand. The amplicons were then purified, subjected to our optimized enzymatic hydrolysis protocol, and finally analyzed by LC-MS/MS (Figure 1). The molar concentration of generated cytosine bases in the PCR amplicon is equivalent to what is expected based on the original methylation status of that gene. As expected, the amplicon hydrolysate showed no deoxythymidine, dT at sites where dC was anticipated. This data showed that the methylation status of the p53 gene in the A549 and HCT116 cancer cells did not change after the treatment with 5-AZA for 72 hours. Interestingly, 5-AZA treatment induced aggregation of nuclear material and decrease in the cell organelles (Figure 2).

Figure 2. Cell painting of HCT116 cancer cells: Control and 5-AZA treated cells are stained with Hoechst (blue), Concanavalin A (green), SYTO14 (Magenta), WGA (yellow), and Mito tracker (deep red). 5-Aza shows aggregation of nuclear material and inhibition of cellular components.

If you are working on an epigenetic drug discovery project and need help quantifying your global DNA methylation or a gene-specific methylation, please reach out to our team to explore your epigenetic needs.

Reference: [i] Skvortsova, K.; Stirzaker, C.; Taberlay, P. The DNA methylation landscape in cancer. Essays Biochem., 2019, 6, 797-811.

The post Gene-specific methylation analysis by LC-MS/MS first appeared on Visikol.

Quantification of Global DNA Methylation Status by LC-MS/MS

Carol Tomaszewski — Tue, 29 Mar 2022 11:58:10 +0000

DNA methylation in mammals occurs at the 5-position of the nitrogen base, cytosine, typically at CpG dinucleotide islands, to produce 5-methylcytosine. DNA methylation is a stable epigenetic mark that has important roles in mammalian development, differentiation and maintenance of cellular identity through the control of gene expression. When occurring in promoter regions, this modification provides stable gene silencing and reduces gene expression and transcription. DNA methylation is enzymatically catalyzed by a class of enzymes called DNA methyltransferases (DNMTs) utilizing S-adenosylmethionine (SAM) as the methyl group donor. SAM is then converted to S-adenosylhomocysteine (SAH) (Figure 1A). Changes in DNA methylation patterns are associated with some pathological conditions such as cancer, of which many forms are characterized by genome-wide hypomethylation and site-specific promoter hypermethylation.

Figure 1. A) Overview of the DNA methylation mechanism.

Figure 1. B) LC-MS/MS chromatogram of 1 µg of A549’s DNA hydrolyzed by DNA Degradase Plus. The chromatogram shows selected base peaks of 5mdC at m/z 126.1, dC at m/z 112.1, and 2′-dG at m/z 152.1. The DNA hydrolysate was separated on an Agilent PoroShell 120 EC-C18 column with an isocratic solvent system composed of 90% H₂O (0.1% (v/v) acetic acid) and 10% ACN (0.1% (v/v) acetic acid).

At Visikol, we developed a robust bioanalytical methodology based on LC-MS/MS for the rapid and accurate quantification of global DNA methylation in each sample. In brief, DNA is extracted from cancer cell lines or tissues and enzymatically hydrolyzed into its corresponding nucleosides by DNA Degradase Plus (Zymo Research, E2021). Nucleosides of interest, namely 2’-deoxycytidine (2’-dC), 5-methyl-2’-deoxycytidine (5mdC), and 2’-deoxyguanosine (2’-dG) are separated on an Agilent PoroShell 120 EC-C18 and quantified by a SCIEX QTRAP 4000 mass spectrometer in the multiple reaction monitoring (MRM) mode (Figure 1B). Linear dsDNA standards at a length of 897 bp (Zymo Research, D5405) were used to construct a calibration curve for global DNA methylation quantification. All DNA standards have the same sequence with either 100% dC, 100% 5mdC, or 100% 5hmdC. The calibration curve was constructed by mixing an increasing amount of hydrolyzed 5mdC in the presence of the same amount of hydrolyzed 2’-dC. To show the applicability of our methodology, two cancer cell lines, A549 (human lung carcinoma) and HCT116 (human colorectal carcinoma), were treated with 5 µM of the DNA methyltransferase inhibitor, 5-azacytidine (5-AZA), for 72 hours, and their global DNA methylation status was assessed by our method.

As expected, 5-AZA treatment showed a 40% and 19% reduction in global DNA methylation status of A549 and HCT116, respectively, compared to their baseline methylation levels (Figure 1C).

If you are working on an epigenetic drug discovery project and need help quantifying your global DNA methylation, please reach out to our team to explore your epigenetic needs.

Figure 1. C) Effect of 5-AZA treatment (5 µM) on the global DNA methylation levels in two cancer cell lines, A549 and HCT116 after 72 hours of treatment.

The post Quantification of Global DNA Methylation Status by LC-MS/MS first appeared on Visikol.