Cell painting image analysis is a transformative technique in the world of life sciences, offering a multidimensional window into the intricate landscapes of cellular biology.

What is Cell Painting?

At its core, cell painting is a high-throughput, phenotypic screening method that uses fluorescent dyes to stain various cellular components and structures. These dyes illuminate specific aspects of the cell, such as the nucleus, cytoskeleton, or mitochondria, making them visible under a microscope. By systematically labeling and imaging cells in this way, scientists generate a treasure trove of data that provides insights into cell health, behavior, and responses to external stimuli.

Scientists at Visikol perform cell painting assays with various treatments on cell lines and generate large sets of data. Then, they develop the workflow of cell painting image analysis based on client’s requirements. This involves a series of steps to process and analyze images obtained through high-throughput microscopy after cells have been stained with fluorescent dyes. This workflow is critical in various fields, including drug discovery, toxicology, and cell biology research.

Here’s a detailed breakdown process.

1. Cell Culture and Treatment:
   • Cultivate the cells of interest in a suitable cell culture medium.
   • Treat the cells with different conditions or compounds, such as drug candidates or experimental treatments. Each condition is often tested in multiple wells.
2. Staining:
   • Apply a set of fluorescent dyes or probes to the cells. These dyes target specific cellular components, such as the nucleus, cytoskeleton, endoplasmic reticulum, and mitochondria.
   • Incubate the cells to allow the dyes to bind and label the cellular structures.
3. Image Acquisition:
   • Use high-throughput microscopy to capture images of the stained cells.
   • Typically, multiple images are taken for each well of a multi-well plate, resulting in a large dataset.
4. Image Preprocessing:
   • Correct for variations in lighting, remove noise, and enhance image quality. Common preprocessing steps include background subtraction, flat-field correction, and noise reduction. This is called Illumination correction.
   • Ensure that the images are in a standardized format and that no artifacts are addressed.
5. Feature Extraction:
   • Employ image analysis software to extract quantitative features from the images. These features may include:
     • Size: Measurements of cell and organelle size.
     • Shape: Geometric properties of cells and cellular components.
     • Texture: Patterns and variations within the cell.
     • Intensity: Fluorescence intensity values for different channels.
     • Spatial distribution: Information on the location and distribution of cellular structures.
6. Data Normalization:
   • Normalize the extracted features to account for variations between different images, wells, or experiments. This step ensures that data from different conditions can be compared accurately.
7. Data Analysis:
   • Apply statistical and machine learning techniques to analyze the normalized data. Common analysis tasks include:
     • Phenotype identification: Classifying cells into different phenotypic categories based on their features.
     • Hit identification: Identifying compounds or conditions that induce specific cellular responses.
     • Pathway analysis: Exploring how specific cellular pathways or processes are affected by treatments.
     • Visualization: Create plots, heatmaps, or other visual representations to interpret and communicate the results.
8. Validation and Further Experiments:
   • Validate the findings through additional experiments, such as follow-up assays or validation screens.
   • Explore the mechanisms behind observed cellular responses, if necessary.
9. Data Interpretation and Reporting:
   • Interpret the results in the context of the research objectives.
   • Prepare reports or presentations to communicate findings to colleagues, stakeholders, or for publication in scientific journals.
10. Iterative Analysis:
    • Depending on the research goals, the analysis may be iterative, with researchers refining their approach and conducting additional experiments as needed.

Visikol has successfully developed this image analysis pipeline and analyzed various cell painting images which aids in screening various drugs in pre-clinical settings. The workflow of image analysis also helps to uncover cellular responses to various treatments and conditions. It plays a crucial role in advancing our understanding of cell biology, drug discovery, and toxicology studies by providing quantitative insights into the effects of different interventions on cellular behavior.

Cell painting image analysis is more than just a technique; it’s an artistic journey into the cellular cosmos. It empowers scientists to decode the intricate language of cells, shedding light on their inner workings and responses. As technology advances and datasets grow larger, the potential for groundbreaking discoveries in fields like drug development and disease understanding is limitless. In the world of cellular exploration, cell painting is the brush that paints the path to discovery. To learn more the cell painting assay, please reach out to a member of our team today!

Multiplexed imaging is a powerful tool that allows researchers to visualize changes in several compartments of the cell with organelle-specific stains. This technique enables researchers to examine changes in cellular pathways with subcellular resolution. In this blog post, we’ll explore how Visikol’s Cell Painting Assay can provide a comprehensive view of cellular pathways, allowing researchers to gain a deeper understanding of how drugs impact cellular processes. From understanding physiological, metabolic, or epigenetic perturbations to analyzing hundreds to thousands of parameters, we’ll explain how Visikol’s Cell Painting Assay can help researchers make informed decisions about which compounds to pursue.

Drug discovery and development is a complex process that involves identifying and testing compounds that can be used to treat diseases. The process can be time-consuming and expensive, and many compounds fail to make it to market. One of the challenges of drug discovery is understanding how drugs interact with cellular pathways. Cellular pathways are complex networks of biochemical reactions that are involved in many physiological processes, including cell growth, differentiation, and death. Understanding how drugs impact cellular pathways is critical to developing effective therapies.

Multiplexed imaging is a technique that allows researchers to visualize multiple markers or stains on a single slide with subcellular resolution. This technique enables researchers to examine changes in several compartments of the cell with organelle-specific stains. The Cell Painting Assay is a high-content, multiplexed image-based assay that utilizes organelle-specific stains to visualize physiological, metabolic, or epigenetic perturbations in different cellular compartments. The assay provides a comprehensive view of cellular pathways by analyzing hundreds to thousands of parameters.

More on Visikol’s Cell Painting Assay

Through the Cell Painting Assay, researchers can gain a deeper understanding of how drugs impact cellular processes by providing a detailed report that allows clients to explore their specific research questions. The assay can be used to understand physiological, metabolic, or epigenetic perturbations by visualizing changes in different cellular compartments. For example, Visikol scientists used the Cell Painting Assay to elucidate the effects of a small molecule anti-proliferative therapeutic and cytochalasin B in cancer cells. The resulting images showed the effects of the drugs on the ER network, cytoskeleton, and mitochondria. This information can be used to develop a better understanding of how the drugs are working and to optimize their use in drug discovery. The Cell Painting Assay is a powerful tool for drug discovery and development. The assay can be used to identify compounds that affect specific cellular pathways, allowing researchers to make informed decisions about which compounds to pursue. The assay can also be used to optimize the use of existing compounds by providing a better understanding of how they work. By using Visikol’s Cell Painting Assay, researchers can “fail faster” by being able to visualize tangible changes at the cellular level.

Visikol’s Cell Painting Assay is a powerful tool for drug discovery and development. The assay provides a comprehensive view of cellular pathways by analyzing hundreds to thousands of parameters. By using the assay, researchers can gain a deeper understanding of how drugs impact cellular processes, allowing them to make informed decisions about which compounds to pursue. Visikol’s Cell Painting Assay is a valuable tool for pharmaceutical companies, pharmaceutical scientists, biochemists, medicinal chemists, pharmacologists, and toxicologists who are involved in drug discovery and development.

To learn more about the Cell Painting Assay, please reach out to a member of our team.

The process of drug discovery is long and complex, often taking years and costing billions of dollars to bring a single drug to market. Traditionally, drug discovery has relied on in vitro assays, which are experiments conducted outside of a living organism, to identify potential drug candidates. However, recent advances in high-content screening have made it possible to get a better understanding of how drugs impact cellular pathways, accelerating the drug discovery process.

High-content screening is a type of drug discovery method that utilizes high-throughput imaging and analysis to assess multiple endpoints simultaneously at a cellular resolution. This approach allows for the interrogation and quantitation of cellular response of disease models to treatments, stimuli, or alterations in protein expression. High-content screening differs from traditional drug discovery methods in that it provides richer datasets than traditional assays, allowing for the examination of the specific effect of compound treatments on specific sub-populations of cells, as well as providing access to more complex measurements than can be accomplished with traditional assay formats.

Visikol Inc. is a contract research services company that specializes in advanced tissue imaging and advanced cell culture services to accelerate the drug discovery and development process. Visikol provides end-to-end services that include 3D tissue imaging, multiplex tissue imaging, digital pathology, 2D cell culture assays and 3D cell culture assays. Visikol’s expertise lies in transforming tissues into actionable insights and bridging the gap between in vitro assays and in vivo results through the use of best-in-class cell culture models.

Cell Painting Assay

One of the services offered by Visikol that can revolutionize the drug discovery process is the Cell Painting Assay. Cell Painting is a high-content, multiplexed image-based assay used for cytological profiling. The technique involves staining several compartments of the cell with organelle-specific stains to visualize phenotypic examination of physiological, metabolic, or epigenetic perturbations. The resulting data can be analyzed using hundreds to thousands of parameters, allowing for the development of mechanical explanations for how a drug is operating and affecting samples.

Visikol scientists used the cell painting technique to elucidate the effects of a small molecule anti-proliferative therapeutic and cytochalasin B in cancer cells. The resulting images showed the effects of the drugs on the ER network, cytoskeleton, and mitochondria. This approach aids pharmaceutical research in solving drug discovery problems with high specificity and sensitivity with high temporal and spatial resolutions.

The Cell Painting Assay is a powerful tool for drug discovery, as it allows researchers to visualize changes at the cellular level and analyze hundreds of parameters. This wealth of information can help researchers make informed decisions about which compounds to pursue, accelerating the drug discovery process. Visikol’s future perspectives include incorporating high-throughput robotics and automation to seed cells and deliver compounds to microplates, improving high throughput technology in imaging and its computational image processing pipeline by integrating the data generated with AI and machine learning tools.

High-content screening is a powerful tool for drug discovery, and Visikol’s Cell Painting Assay is a game-changer in this field. By providing researchers with a wealth of information about how drugs impact cellular pathways, the Cell Painting Assay can help researchers make informed decisions about which compounds to pursue. Reach out to a member of our team if you’re interested in learning more. 

DNA methylation is a critical epigenetic modification that controls gene expression and genome stability, which has oncogenic implications during cancer initiation. DNA methylation occurs mainly on the CpG islands, which are mainly enriched at gene promoters. Hypermethylated promoters have been shown to silence the corresponding gene expression, while hypomethylation has the opposite effect. Interestingly, cancer is associated with mixed DNA methylation dysregulation, which includes a genome-wide hypomethylation and hypermethylation associated with the silencing of vital tumor-suppressor genes.[i] Retrieving gene-methylation patterns is an important biomarker for early cancer prediction and other diseases.

Whole-genome bisulfite sequencing is a well-established protocol for detecting methylated cytosines in genomic DNA. This protocol uses bisulfite-based deamination of unmethylated cytosine into uracil bases, while the methylated cytosine bases are unaffected. During sequencing, uracil bases are deaminated into thymidine, while methylated cytosines, which resisted the deamination step, are sequenced into cytosines (Figure 1A). Site-specific quantification of the generated cytosines provides information on the methylation status of the selected DNA region. One of the tools that can be used to retrieve such information is the LC-MS/MS.

Visikol has recently developed a sensitive bioanalytical method for the quantification of global DNA methylation by LC-MS/MS, which is based on the enzymatic hydrolysis of the genomic DNA and the simultaneous quantification of the corresponding nucleotides, 5-methyl-2’-deoxycytidine (5mdC), and 2’-deoxycytidine (dC), using the QTRAP 4000 mass spectrometer. This method was used to measure the changes in the global DNA methylation status of two cancer cell lines, A549 (human lung carcinoma) and HCT116 (human colorectal carcinoma), following the treatment with 5 µM of the DNA methyltransferase inhibitor 5-azacytidine (5-AZA). Using the DNA samples extracted from the 5-AZA-treated HCT116 cancer cell line, we extended the applicability of our method to quantify DNA methylation of the promoter region of the tumor suppressor gene, the p53 gene. Briefly, DNA samples were bisulfite converted, which then underwent a PCR amplification based on the following primers: ATTGTTTAGTTTTGTGTTAGGAGTTT, forward strand, and TCAATCAAAAACTTACCCAATCC for the reverse strand. The amplicons were then purified, subjected to our optimized enzymatic hydrolysis protocol, and finally analyzed by LC-MS/MS (Figure 1). The molar concentration of generated cytosine bases in the PCR amplicon is equivalent to what is expected based on the original methylation status of that gene. As expected, the amplicon hydrolysate showed no deoxythymidine, dT at sites where dC was anticipated. This data showed that the methylation status of the p53 gene in the A549 and HCT116 cancer cells did not change after the treatment with 5-AZA for 72 hours. Interestingly, 5-AZA treatment induced aggregation of nuclear material and decrease in the cell organelles (Figure 2).

If you are working on an epigenetic drug discovery project and need help quantifying your global DNA methylation or a gene-specific methylation, please reach out to our team to explore your epigenetic needs.

Reference:   [i] Skvortsova, K.; Stirzaker, C.; Taberlay, P. The DNA methylation landscape in cancer. Essays Biochem., 2019, 6, 797-811.

The cell painting assay is a high-content image-based method for morphological profiling using fluorescent dyes. These dyes reveal relevant cellular components that can be used to simultaneously investigate numerous biological pathways upon a given perturbation. The resulting images can be analyzed using different image analysis techniques to provide phenotypic profiles of individual cells, as well as serve as input for machine or deep learning approaches. This method  has been successfully used to study compound toxicity, predict biomarkers, detect morphological disease signatures, and give insights into the mechanism of action of both existing and novel compounds in the field of pharmacology and toxicology. Immunofluorescence based drug screening methods depend on the use of specific antibodies for the visualization and quantification of drug-affected cells.

Visikol has combined cell painting with antibody-based detection of fibrotic proteins in a single assay. This experiment makes use of a modified cell painting protocol by incorporating antibody labelling, which can be used for the unbiased morphological profiling of drug effect on cells. This method can identify anti-fibrotic compounds, as well as novel drugs, demonstrating its suitability to be implemented as a strategy for either drug repurposing or drug discovery.

If you are interested in utilizing this cell painting in combination with antibody labeling approach for your drug discovery projects, please reach out to our team to discuss your project. We are always interested to work together with our clients to develop customized drug discovery solutions to answer your research questions. Based on requirements, we can design custom image analysis pipeline for segmentation and classification of biomarkers of interest.

References:

1)         Bray et al.,  et al. Cell Painting, a high-content image-based assay for morphological profiling using multiplexed fluorescent dyes. Nat Protoc. 2016;11:1757–74.

2)         Caicedo , et al. Data analysis strategies for image-based cell profiling. Nat Methods. 2017;14:849–63

3)         Axel Pahl and Sonja Sievers.  The Cell Painting Assay as a Screening Tool for the Discovery of Bioactivities in New Chemical Matter. Methods Mol Biol . 2019;1888:115-126.

Many human diseases are caused by morphological, physiological or genetic changes in cells. The challenges of disease diagnosis include the evolving nature of the disease, disease symptoms and the diagnostic process. Statistics on the frequency of missed diagnoses differ according to the symptoms or the eventual diagnosis. For hundreds of years, microscopy has been used to study the ultra-structural and physiological changes of the living cells. Based on the recent advancements in the field of microscopy, scientists have developed the cell painting technique, which is a high-content, multiplexed image-based assay used for cytological profiling. Since several compartments of cells are “painted” using different stains, cell painting has become a powerful phenotypic assay adopted by the academic screening centers and pharmaceutical industry for pathological diagnosis of cells as well as drug discovery.

What is Cell Painting?

Briefly, in cell painting, compound-induced phenotypic features will be imaged. With the help of high content microscopic imaging, phenotypic examination of physiological, metabolic or epigenetic perturbations in different cellular compartments can be visualized. Using different fluorescent dyes, various cellular compartments are stained and imaged. Finally, the image analysis workflow involves image segmentation and extraction of hundreds to thousands of parameters. One of the advantages of a cell-painting driven screen is that the phenotypic clustering will be independent of a known target. This enables identification of novel compounds with different mechanisms of action.

The team at Visikol is making great strides in the pathological diagnosis of cells thereby leveraging drug discovery efforts.  If you are interested in utilizing this cell painting approach for your drug discovery projects, please reach out to our team to discuss your project. We are always interested to work together with our clients to develop customized drug discovery solutions to answer your research questions.

Top Panel: A549 cells treated with different concentrations of an anti-proliferative compound. Merged images show nucleus (stained by Hoechst), cytoskeleton (stained by Phalloidin), and  mitochondria (stained by MitoTracker). The anti-proliferative compound inhibits cytoskeleton formation and induces disintegration of mitochondria.

Bottom Panel: A549 cells treated with different concentrations of Cytochalasin B. Merged images show nucleus (stained by Hoechst), cytoskeleton (stained by Phalloidin), and  nucleoli (stained by SYTO14). Cytochalasin B inhibits cytoskeleton formation and disintegrates nucleoli.